The influence of divalent metal ions on low pH induced LacDNA structural changes as probed with UV resonance Raman spectroscopy

Autor(en): Muntean, Cristina M.
Salehi, Mohammad
Niebling, Stephan
Walkenfort, Bernd
Stichwörter: AQUEOUS SYSTEMS; COMPLEXES; Difference spectra; Divalent metal ions; DNA-STRUCTURE; DRUGS; GENOMIC DNA; LacDNA protonation; LacDNA structure; LASER EXCITATION; NUCLEIC-ACIDS; PROTEIN; Spectroscopy; STRANDED-DNA; TRANSITION; UV resonance Raman spectroscopy
Erscheinungsdatum: 2013
Herausgeber: WILEY-BLACKWELL
Journal: JOURNAL OF RAMAN SPECTROSCOPY
Volumen: 44
Ausgabe: 12
Startseite: 1693
Seitenende: 1699
Zusammenfassung: 
UV (275nm) resonance Raman spectra of LacDNA 22-mer duplex [d(TAATGTGAGTTAGCTCACTCAT).d(ATGAGTGAGCTAACTCACATTA)], which contain protein binding sites within the E. coli lac promoter, were measured at two pH values (6.4 and 3.45) in the absence and presence of Mn2+ and Ca2+ metal ions, respectively. Also, the UV (275nm) resonance Raman markers of the corresponding oligonucleotide d(TAATGTGAGTTAGCTCACTCAT) and of its complementary anti-sense strand d(ATGAGTGAGCTAACTCACATTA) were established and tentatively assigned. Large changes in the UV (275nm) resonance Raman spectra of LacDNA duplex were observed at pH3.45 as compared with the corresponding spectrum at pH6.4, in the absence of divalent metal ions and at low concentrations of Ca2+ ions, respectively. Major changes comprise: adenine protonation, GC base pair protonation, DNA bases unstacking and changes in the hydrogen bonding strength between the strands of different LacDNA complexes, respectively. Divalent metal ions (Mn2+ and Ca2+) were found to inhibit LacDNA protonation even at low concentrations. Manganese(II) ions are much more effective in this regard, as compared with calcium(II) ions. Binding of Mn2+ ions to N7 of guanine and, possibly, in a lesser extent to adenine was observed as judging from the difference Raman bands at 1315, 1354 and 1493cm(-1). Copyright (c) 2013 John Wiley & Sons, Ltd.
ISSN: 03770486
DOI: 10.1002/jrs.4407

Show full item record

Google ScholarTM

Check

Altmetric